circad | circRNAs associated with diseases

circFAM169A
Gene	FAM169A	Organism	Human
Genome Locus	chr5:74109664-74137504:-	Build	hg19
Disease	Bladder Cancer	ICD-10	Malignant neoplasm of Bladder, unspecified (C67.9)
DBLink	Link to database	PMID	27484176
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Four pairs of snap-frozen bladder carcinoma tissue and matched para-carcinoma tissue
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAGGTAAAGATTTTGGGCTTCACA Reverse GGATTTTCAGGGTCCCCACA	Statistics	Fold Change : Downregulated,0.000618958 pvalue : p=10.4740421
Citation
Zhong, Z, Lv, M, Chen, J (2016). Screening differential circular RNA expression profiles reveals the regulatory role of circTCF25-miR-103a-3p/miR-107-CDK6 pathway in bladder carcinoma. Sci Rep, 6:30919.